getpdf NLM PubMed Logo https://doi.org/10.17113/ftb.64.01.26.9231          

Single-Tube Loop-Mediated Isothermal Amplification Assay Targeting the inlA Gene for Sensitive Detection of Listeria monocytogenes in Food

Anna Maraz1*orcid tiny, Melinda Pazmandi1orcid tiny, Kristof Ivan2orcid tiny and Agnes Belak1orcid tiny

1Department of Food Microbiology, Hygiene and Safety, Institute of Food Science and Technology, Hungarian University of Agriculture and Life Sciences, Somloi ut 14-16, 1118 Budapest, Hungary

2Faculty of Information Technology and Bionics, Pazmany Peter Catholic University, Prater utca 50/A, 1083 Budapest, Hungary

cc by Copyright © 2024 This is a Diamond Open Access article published under CC-BY licence. Copyright remains with the authors, who grant third parties the unrestricted right to use, copy, distribute and reproduce the article as long as the original author(s) and source are acknowledged.

Food Technol. Biotechnol. 2026; 64(1): pp. 113-125.

Article history:

Received: 15 June 2025

Accepted: 9 March 2026

Keywords:

loop-mediated isothermal amplification (LAMP); Listeria monocytogenes; detection; inlA  

E WEB Goal 03E WEB Goal 09The content of this publication has not been approved by the United Nations and does not reflect the views of the United Nations or its officials or Member States.

Summary:

Research background. Several loop-mediated isothermal amplification (LAMP) assays with good performance characteristics have been developed for the detection of Listeria monocytogenes in food; however, there are only a few cases in which DNA extraction, amplification and sensing have been performed in a single-tube system.

Experimental approach. The efficiency of DNA extraction by lysis buffers was tested using LAMP. New primer sets for LAMP assays were designed using PrimerExplorer V5 software. The sensitivity and specificity of the LAMP inner primers were determined by optimised PCR. The end-point detection involved gel electrophoresis, turbidity and eriochrome black T (EBT) colour reaction. The sensitivity, specificity and limit of detection (LOD) of the developed LAMP assays were then characterised using L. monocytogenes, non-monocytogenes Listeria and non-Listeria bacterial strains.

Results and conclusions. Both the alkaline cell lysis-based sodium hydroxide and Tris-HCl (HotSHOT)+Tween buffer and the Triton X-100 and sodium azide-based TZ buffer generated amplifiable DNA templates under isothermal conditions for LAMP. However, the TZ buffer produced a significantly higher DNA yield than the HotSHOT+Tween buffer. LAMP primers were designed to target the hlyA and inlA virulence genes of L. monocytogenes. The sensitivity and specificity of the LAMP inner primers were 100 % for both genes; however, the PCR reaction targeting the inlA gene generated fewer non-specific PCR products than the hlyA-targeting PCR. The sensitivity of the InlA LAMP assay was 100 %, while its specificity was 96 %. The LOD was 500 fg per reaction, which corresponds to 157 genome copy numbers. The combination of DNA extraction, LAMP amplification, and colorimetric endpoint detection in a single tube resulted in a LAMP assay suitable for the detection of L. monocytogenes in food under laboratory conditions, with potential for further development for on-site detection with microfluidic platforms.

Novelty and scientific contribution. To the best of our knowledge, this is the first report of a LAMP assay targeting the inlA gene of L. monocytogenes. The developed single-tube LAMP assay is well-suited for integration with microfluidic systems.

*Corresponding author: +36309496988
  +3613057340
  This email address is being protected from spambots. You need JavaScript enabled to view it.

INTRODUCTION

In the global context of foodborne illnesses, bacteria have been identified as the predominant contaminants responsible for most outbreaks worldwide (1, 2). Listeria monocytogenes is the leading foodborne pathogen isolated from various food products. Ingestion of contaminated foods allows the bacterium to proliferate, leading to sporadic cases of listeriosis (3, 4).

L. monocytogenes isolates originating from food and food processing environments belong mostly to lineage II, which comprises serotypes 1/2a, 1/2c and 3a, and less frequently to lineage I, which includes serotypes 1/2b, 3b, 3c and 4b (5). Analysis of epidemiological data has determined that the 1/2a, 1/2b and 4b serotypes of L. monocytogenes account for the majority of human outbreaks, despite there being 13 serotypes that have the potential to infect humans. These findings suggest that certain L. monocytogenes subtypes are better adapted to food-associated environments and human infection (6).

Detection of L. monocytogenes in food matrices presents several challenges, such as low numbers and uneven distribution of the cells, presence of background microbiota, stress-induced viable but non-culturable (VBNC) state, complexity of food matrices, biofilm formation or differentiation from other Listeria species (7-9).

Conventional (culture-based) methods are the gold standard for microbiological analysis, as they provide reliable detection and quantification of pathogenic bacteria in foods, from the enrichment to the identification under simple laboratory conditions. Pre-enrichment of food samples in non-selective or selective culture media can increase the number of viable but injured bacterial cells that pose a potential threat to human health to a level that can be detected (10). Enrichment steps, including selective enrichment and selective plating, may require an additional period of 8–24 hours before detection or enumeration can be completed. These steps are usually followed by biochemical testing, serological confirmation and identification by conventional and alternative methods (11, 12).

Various standard methods are available for the isolation and detection of L. monocytogenes from food products, which are different in the enrichment and detection techniques (3). The internationally recognised and applied ISO 11290-1:2017 standard (13) consists of a two-step enrichment process involving the incubation of samples (25 g) in half Fraser broth for 24-26 h, followed by inoculation at a 1:100 ratio into full Fraser broth to further enrich the bacterial cultures for 24 h. Pre-enriched and enriched samples are streaked onto selective chromogenic agar plates and presumptive colonies are confirmed.

The use of conventional culture-based methods is time-consuming and labour-intensive (14, 15). Consequently, a wide range of alternative methods have been developed for microbiological food analysis, providing solutions to the limitations of culture-based methods. Molecular DNA amplification techniques such as loop-mediated isothermal amplification (LAMP) play a leading role among them with continuous efforts for development (11, 15).

LAMP was developed by Notomi et al. (16) at Eiken Chemical Co., Ltd., Tokyo, Japan, and is now used in many areas of microbiology (17). LAMP has several advantages, such as simplicity, robustness, low equipment and operation costs, and versatility. DNA amplification does not require heat denaturation before primer attachment, and the reaction is carried out at an isothermal temperature (around 65 °C) using special DNA polymerases with strand displacement activity (17-19). In the LAMP assay, four different primers recognise six different sites on the target DNA, initiating the amplification reaction. Two additional primers bind to four other sites in the template DNA, which ensures a high degree of specificity. As a result of polymerase activity, hairpin loops of different sizes and cauliflower-like structures comprising multiple loops are formed. The target DNA is amplified 109–1010-fold in 15–60 min (18).

Mori et al. (20) found that precipitation of magnesium pyrophosphate during DNA synthesis is proportional to the generated amplicons and can be detected visually or monitored using a real-time turbidimeter. Besides turbidity, endpoint detection can also be achieved using the fluorescent dye calcein (18), adenosine triphosphate (ATP) bioluminescence, and colour changes (21). Colorimetric assays are very promising, especially the use of metal indicators that detect the decrease in Mg2+ concentration during the amplification reaction. Goto et al. (22) developed the first colorimetric detection based on the reaction of hydroxynaphthol blue (HNB) and Mg2+. This method is characterised by a change in colour from purple to blue as the concentration of Mg2+ decreases. Oh et al. (23) applied a new colorimetric sensor based on the reaction of the metal indicator Eriochrome Black T (EBT) and Mg2+.

A crucial aspect of developing new LAMP assays and designing suitable primer sets is the selection of an appropriate gene that ensures specificity and sensitivity. For pathogenic microbes, virulence genes are primarily considered as target genes for designing LAMP primers. The virulence genes of L. monocytogenes are common to almost all L. monocytogenes cell lines, but are typically absent from non-pathogenic Listeria species, including the genome of L. innocua (24). Most virulence determinants of L. monocytogenes interfere with the cytoplasmic movement of the infected epithelial cells, involving actin-based motility and cell-to-cell spreading. Adhesion proteins like Listeria adhesion protein (LAP) participate in the first step of intracellular infection. LAP has a crucial role in epithelium crossing; however, LAP homologues are present in both pathogenic and non-pathogenic Listeria species. The invasion process is directed by several virulence proteins. Internalin A (InlA) and Internalin B (InlB), encoded by the inlA and inlB, respectively, are responsible for the internalization into the enterocytes and pass through the M-cells of Peyer’s patches. After invasion, bacterial cells are confined within phagosomes inside the enterocytes, which are disrupted by the toxin listeriolysin O (LLO) encoded by hlyA, in collaboration with two phospholipases PlcA and PlcB, encoded by plcA and plcB, respectively. As a result, bacteria are released into the cytosol, where they continue to multiply and spread to other cells. Virulence in Listeria is efficiently regulated by the PrfA protein, which controls the expression of most virulence genes, such as inlA, inlB, hlyA, plcA and plcB (3, 25). Raybourne (26) found that the virulence genes hlyA, actA, mpl, iap and inlA are present in almost all wild-type L. monocytogenes isolates; however, Bubert et al. (27) published that iap gene encoding the protein p60 is common to all Listeria.

Most publications report on L. monocytogenes-specific LAMP assays designed for the detection of the hlyA gene, as well as the metalloprotease (Mpl) gene (28), the lmo0753 gene coding for a PrfA-like transcription regulator (29), and the iron transport protein gene feoB (30). As more partial and whole genome sequences of L. monocytogenes strains are publicly available, it is possible to select highly conserved virulence genes and increase the specificity of LAMP assay by identifying conserved regions of the selected genes.

Inhibitor-free, fully or partially purified DNA templates are used in conventional LAMP, which provides suitable conditions for standardising the reaction. Several commercial kits are available for template preparation, which differ in their methods of DNA extraction and purification from bacterial cells. In the simplest procedures, nucleic acids are precipitated from the cell lysates with a solvent (ethanol or propanol), followed by RNase treatment, precipitation, or column separation and concentration of DNA (31).

The use of commercial DNA isolation kits for DNA extraction from different bacteria often faces the problem that DNA extraction from Gram-positive bacteria is generally less efficient than from Gram-negative ones (31, 32). DNA extraction from bacterial cells requires mechanical or enzymatic disruption of the cell wall before using the kits. Standardization of mechanical cell disruption is not an easy task and instruments for molecular biological purposes, especially for parallel processing of multiple small samples, are not readily available. Proteinase K and/or lysozyme are usually used for enzymatic cell wall disintegration. However, reaction conditions are generally difficult to standardise, and cell wall disintegration is greatly influenced by the properties of the cells being treated. Gram-positive bacteria are much more resistant than Gram-negative ones, and older or stressed cells are also less sensitive than young, fast-growing cells. Proteinase K solution must be inactivated by heat treatment (at 90-100 °C) before the amplification reaction, as it can attack DNA polymerases. Lysozyme is better in this respect, as it does not influence DNA polymerases (31-33).

Cell disintegration methods are based on two principles (Table 1 (34-37)). One is the alkaline cell lysis, which is carried out using NaOH, while EDTA-Na2 is added to inhibit nucleases. Truett et al. (34) combined alkaline cell lysis with heat treatment, then adjusted the pH with a neutralizing solution to a value optimal for the PCR reaction (HotSHOT), which resulted in PCR-quality mouse cell extracts. Brewster and Paoli (35) further developed the HotSHOT method for extracting DNA from pathogenic bacteria; however, a 2- or 5-fold increase in NaOH and the addition of Tween 20 were required to achieve effective cell lysis in both Gram-negative and Gram-positive bacteria. An advantage of this method compared to the above-mentioned one (34) is that a heat treatment of 65 °C is used during cell lysis instead of 95 °C.

Lysis buffers and treatment conditions used for the preparation of DNA extracts for PCR

Lysis buffer Active ingredient Composition Complementary treatment Reference
HotSHOT NaOH 25 mM NaOH, 0.2 mM EDTA-Na2 Lysis: 95 °C, 10 min
Neutralization: 40 mM Tris-HCl
Truett et al. (34)
HotSHOT 2× + Tween NaOH
Tween 20
50 mM NaOH, 0.4 mM EDTA-Na2, 0.1 % Tween 20 Lysis: 65 °C, 15 min
Neutralization: 50 mM HCl, 10 mM Tris-HCl
Brewster and Paoli (35)
HotSHOT 5× + Tween NaOH
Tween 20
125 mM NaOH, 1 mM EDTA-Na2, 0.1 % Tween 20 Lysis: 65 °C, 15 min
Neutralization: 50 mM HCl, 10 mM Tris-HCl
Brewster and Paoli (35)
Triton X-100 Triton X-100 2 % Triton X-100 100 °C, 10 min Agersborg et al. (36)
TZ Triton X-100
Na-azide
2 % Triton X-100, 25 mM Na-azide, 0.1 M Tris-HCl, pH=8 Lysis: 100 °C, 15 min Abolmaaty et al. (37)

In the second type of cell disintegration technique, the addition of nonionic surfactant Triton X-100 improves the efficiency of cell lysis. Agersborg et al. (36) established conditions for the lysis of L. monocytogenes cells with a solution containing Triton X-100 in combination with a 10-minute heat treatment at 100 °C. Abolmaaty et al. (37) further developed this method by adding sodium azide and using the solution they called TZ lysis buffer. Brewster and Paoli (35) confirmed that cell disintegration with TZ buffer is suitable for the preparation of cell lysates for direct PCR amplification from several bacteria.

Future trends in the development of molecular techniques are to simplify instrumentation, increase the reliability of endpoint detection, and enable on-site application (11, 38). Microfluidic biosensors, also known as lab-on-a-chip (LOC), meet these expectations. LOCs can perform a complex laboratory diagnosis on a portable chip, embedding the entire analytical system from the sample preparation to the sensing stage in a single device. The low manufacturing cost allows for mass production and disposability of the devices. The advantage of LOC systems is not only the price, but also their portability, speed, accuracy and automation (39).

Microfluidic platforms combine molecular diagnostic techniques with simple, disposable or reusable analytical devices for pathogen detection in food, which meet the affordable, sensitive, specific, user-friendly, rapid and robust, equipment-free, deliverable to end users (ASSURED) criteria, set by the World Health Organisation (WHO) as a diagnostic device standard especially for developing countries (38-40).

It is advantageous if the DNA template from the enriched food sample is produced in a single tube under closed conditions, especially if a microfluidic chip is used for the detection of foodborne pathogenic bacteria. Another advantage is that there is no need for high heat treatment, e.g. 90–100 °C, during or after cell disintegration, as this allows production of DNA extract directly in a heat-sensitive chip. Furthermore, if DNA extraction and amplification take place in a single tube under isothermal conditions, this technique can be directly implemented in microfluidic devices. Closed tube system can decrease the risk of carryover contamination, which is one of the major drawbacks of LAMP (17).

Our goal is to implement a single-tube system for cell lysis and amplification, which is suitable for the detection of L. monocytogenes by LAMP under laboratory conditions and can be implemented in microfluidic devices. Since LAMP is equally or even slightly more tolerant to inhibitors than PCR (41), we focused on the cell lysis and DNA extraction procedures, which were tested and evaluated in PCR. This was followed by designing LAMP assays for the detection of L. monocytogenes virulence genes and selecting the best-performing LAMP assay for detection purposes.

MATERIALS AND METHODS

Microorganisms used in this study

The list of strains and their origin is shown in Table 2.

Microorganisms used in this study

No. Strain Culture collection/origin
Listeria monocytogenes strains
1 Listeria monocytogenes NCAIM B01966 NCAIM
2 Listeria monocytogenes CCM 4699 (ATCC 19117) CCM
3 Listeria monocytogenes NCTC 5105 (serovar 3a) NCTC
4 Listeria monocytogenes DMB E ST/10.12. 2 DFMHS/cheese
5 Listeria monocytogenes DMB 46 DFMHS
6 Listeria monocytogenes DMB H1 DFMHS/meat processing
7 Listeria monocytogenes DMB 80 DFMHS/milk
8 Listeria monocytogenes DMB H2 DFMHS/meat processing
9 Listeria monocytogenes DMB H6 DFMHS/meat processing
10 Listeria monocytogenes DMB E 12/10.12. 3 DFMHS
11 Listeria monocytogenes DMB 43 DFMHS
12 Listeria monocytogenes DMB 8 DFMHS
Non-monocytogenes Listeria strains
1 Listeria innocua CCM 4030T CCM
2 Listeria innocua DMB 291 DFMHS
3 Listeria innocua DMB 217 DFMHS
4 Listeria innocua DMB 4191 DFMHS/meat
5 Listeria innocua DMB 1969 DFMHS
6 Listeria innocua NCAIM B01830 NCAIM
7 Listeria ivanovii ssp. ivanovii CCM 5884T CCM
8 Listeria ivanovii DMB 1149 DFMHS
9 Listeria ivanovii DMB 1150 DFMHS
10 Listeria ivanovii DMB T7 DFMHS
11 Listera grayi DMB 1160 DFMHS
12 Listera grayi DMB 1161 DFMHS
13 Listeria seeligeri DMB 1153 DFMHS
14 Listeria welshimeri CCM 3971T CCM
15 Listeria welshimeri DMB 1157 DFMHS
Non-Listeria bacterial strains
1 Lactococcus lactis A1 DFMHS
2 Lactococcus cremoris B1 DFMHS
3 Bacillus cereus PA1 DFMHS
4 Staphylococcus epidermidis PA2 DFMHS
5 Lactobacillus delbrueckii ssp. bulgaricus B397 IDM
6 Lactobacillus acidophilus N2 IDM
7 Pseudomonas fluorescens CCM 2115T CCM
8 Pseudomonas lundensis CCM 3503T CCM
9 Campylobacter jejuni ssp. jejuni CCM 6214T CCM
10 E. coli ATCC 8739 ATCC

CCM=Czech Collection of Microorganisms, Masaryk University, Brno, Czech Republic; ATCC=American Type Culture Collection, Rockville, MD, USA; NCAIM=National Collection of Agricultural and Industrial Microorganisms, Budapest, Hungary; DFMHS=Department of Food Microbiology, Hygiene and Safety, MATE, Budapest, Hungary; NCTC=National Collection of Type Cultures, UK Health Security Agency, Salisbury, UK; IDM=Institute of Dairy Microbiology, Agricultural Faculty, University of Perugia, Perugia, Italy

DNA isolation from pure bacterial cultures

Tryptic soy broth (TSB; Sigma-Aldrich, Merck, St. Louis, MO, USA) was used as the culture medium for overnight propagation of Listeria, Bacillus, Staphylococcus, Pseudomonas and E. coli, while lactic acid bacteria were cultivated for 48 h in MRS broth (Biolab Ltd., Budapest, Hungary) under anaerobic conditions (Anaerocult A; Merck KGaA, Darmstadt, Germany) at 30 °C. An overnight propagation of Campylobacter jejuni was performed using a Columbia blood agar plate containing 5 % sterile defibrinated sheep blood (Sigma-Aldrich, Merck) at 37 °C in a microaerophilic environment (Anaerocult C; Merck KGaA).

DNA was isolated using MasterPure Complete DNA and RNA Purification Kit (Epicentre, Madison, WI, USA) according to the manufacturer’s instructions.

Treatment of L. monocytogenes cells with lysis buffers

Overnight culture of L. monocytogenes CCM 4699 in TSB (Sigma-Aldrich, Merck) was inoculated into TSB or Fraser enrichment broth (Noack and Co. GmbH, Vienna, Austria) at 104 cell/mL and incubated at 30 °C for 24 h by shaking (190 rpm). A volume of 1 mL culture containing 108 cells was measured into an Eppendorf tube, cells were sedimented by centrifugation at 13 500×g for 4 min at 5 °C (Z216-MK microcentrifuge; HERMLE Benchmark, Sayreville, NJ, USA) and the supernatant was discarded. Cells were resuspended in 100 µL lysis buffers (HotSHOT+Tween and TZ) and treated as described in Table 1.

DNA isolation from cell lysates

Cell debris was sedimented by centrifugation of 100 µL lysed cells (13 500×g, 4 min, 5 °C; Z216-MK microcentrifuge; HERMLE Benchmark) and the supernatant was transferred to a new Eppendorf tube. Nucleic acids (NA) were precipitated with equal volume of iso-propanol and sedimented by centrifugation (13 500×g, 4 min, 5 °C). The pellet was washed with 70 % ethanol and dried in SpeedVac Vacuum Concentrator (Thermo Fisher Scientific, Seattle, WA, USA). NA were dissolved in 50 µL TE (Tris-EDTA) buffer, 15 µL RNase solution (10 mg/mL) was added, and the mixture was incubated at 37 °C for 30 min. DNA precipitation was repeated, and the purified DNA was dissolved in 50 µL TE buffer. DNA concentration was measured with NanoDrop microvolume spectrophotometer (Thermo Fisher Scientific).

Calculation of DNA copy number

Cell number of the L. monocytogenes suspensions was determined by plating the cells in tryptic soy agar (TSA; Sigma-Aldrich, Merck). Genome copy number of the extracted DNA was calculated by the Staroscik Copy number calculator of Technology Networks (42):


/1/

where X is the number of copies per µL, γ(DNA) is the DNA concentration (ng/µL), NA is Avogadro’s number (6.0221·1023 mol-1), C is the genome size of the organism expressed in number of base pairs (bp), and Mbp is the average mass of a base pair (650 Da).

According to the NCBI database, genome size of L. monocytogenes CCM 4699 (ATCC 19117) strain is 2 951 805 bp (Genome assembly ASM30702v1 (43)).

LAMP assay targeting the hlyA gene

The total reaction volume was 25 µL containing the components as described by Tang et al. (44). The LAMP reaction consisted of a 60-minute amplification step at 65 °C and a 10-minute enzyme inactivation step at 80 °C.

Detection of the amplicons by gel electrophoresis

LAMP products were separated in 1 % agarose gel (SeaKem LE Agarose; Lonza, Basel, Switzerland) by electrophoresis at 120 V for 45 min. DNA bands were visualised by ethidium bromide staining.

Development of LAMP assays

PrimerExplorer V5 software (45, 46) was used to design LAMP primer sets specific to the genes encoding the listeriolysin O (hlyA) and internalin A (inlA) of L. monocytogenes. The nucleotide sequences of the hlyA and inlA of L. monocytogenes strains N53-1 (accession number: HE999705; GenBank, NCBI) and NRRL B-33220 (accession number: DQ844405, GenBank, NCBI), respectively (43), provided the basis for the primer design.

For the detection of these genes, LAMP primer sets were designed, and the sensitivity and specificity of the LAMP inner primers (FIP and BIP) with an optimised PCR reaction were calculated. For the PCR detection of these genes, inner PCR primers (F2-B2) were designed based on the nucleotide sequences of the inner LAMP primers FIP and BIP.

HlyA-old primer sets

Primers (5’-3’) for the LAMP reaction were (44): F3-H-old: TTGCGCAACAAACTGAAGC; B3-H-old: GCTTTTACGAGAGCACCTGG; LF-H-old: TAGGACTTGCAGGCGGAGATG; LB-H-old: GCCAAGAAAAGGTTACAAAGATGG; FIP: CGTGTTCTTTTCGATTGGCGTCTTTTTTTCATCCATGGCACCACC; and BIP: CCACGGAGATGCAGTGACAAATGTTTTGGATTTCTTCTTTTTCTCCACAAC.

Inner primers (5’-3’) for the PCR reaction were: F2-H-old: TTTCATCCATGGCACCACC; and B2-H-old: GGATTTCTTCTTTTTCTCCACAAC.

HlyA-new primer sets

Primers (5’-3’) for the LAMP reaction were: F3-H-new: GTCTCAGGTGATGTAGAACT; B3-H-new: TGTCTTTTAGGAAGTTTGTTGT; LF-H-new: TTGCGGAACCTCCGTAAATTAC; LB-H-new: AAGGCGCTACTTTTAATCGAGAAAC; FIP: CCGTCGATGATTTGAACTTCATCTTTCAAAAATTCTTCCTTCAAAGCC; and BIP: CAACCTCGGAGACTTACGAGAATAAGCAATGGGAACTCCT.

Inner primers (5’-3’) for the PCR reaction were: F2-H-new: TCAAAAATTCTTCCTTCAAAGCC; and B2-H-new: ATAAGCAATGGGAACTCCT.

InlA primer sets

Primers (5’-3’) for the LAMP reaction were: F3-I: TGCCAGCAAATGATATTACG; B3-I: TGCTTTTGAATTATAAGGGTCAT; LF-I: GGTGGTGCCACAGGATTTT; LB-I: GAAGCAACACATCTAACACATCAAC; FIP: CTCCGTTATTTGTAGTCGGCGGCTGTACGCTCAATTCACGA; and BIP: CCACCTTCCGCAAATATACCTGGTTCATTGTACTTGTTGTGCT.

Inner primers (5’-3’) for the PCR reaction were: F2-I: CTGTACGCTCAATTCACGA; and B2-I: GTTCATTGTACTTGTTGTGCT.

PCR reaction

Composition of the PCR mixture (V=25 μL) was: 0.2 μM of each F2 and B2 primer pair, 0.1 mM dNTP, 1×Taq polymerase buffer, 0.7 mM MgCl2, 0.024 U/µL Taq DNA polymerase (New England Biolabs, Ipswich, MA, USA) and 2 ng/µL template DNA. Parameters of the PCR reaction were: (i) pre-denaturation at 95 °C for 5 min, (ii) denaturation at 95 °C for 20 s, (iii) primer annealing at 52 °C for 30 s, (iv) elongation at 72 °C for 30 s (steps (ii), (iii) and (iv) were repeated 35 times), and (v) final elongation at 72 °C for 3 min.

InlA LAMP assay with EBT endpoint detection

Composition of the LAMP mixture (V=25 μL) was: F3: 0.2 µM, B3: 0.2 µM, FIP: 1.6 μM, BIP: 1.6 µM, LF: 0.8 µM, LB: 0.8 µM, dNTP: 1.2 mM, betaine: 0.6 M, Thermopol reaction buffer (New England Biolabs): 1×, MgSO4: 6 mM, Bst 2.0 Warm Start DNA polymerase (New England Biolabs): 0.32 U/µL, Eriochrome® black T (EBT): 120 µM, DNA extract: 2 ng/µL of reaction or cell lysate: 0.04 µL/µL of reaction.

The LAMP reaction consisted of a 60-minute amplification step at 65 °C and a 10-minute enzyme inactivation step at 80 °C.

Determination of performance characteristics of LAMP assays

Determination of sensitivity and specificity

DNA was isolated from ten L. monocytogenes, ten non-monocytogenes Listeria and ten non-Listeria bacterial strains and then the purified genomic DNA was amplified with the LAMP assay applying the EBT endpoint detection.

Sensitivity (SE/%) and specificity (SP/%) were calculated using the following equations:


/2/

/3/

where N+ is the number of true positives, N is the number of true negatives, PA is the number of positives obtained by LAMP (alternative) method, and NA is the number of negatives obtained by LAMP (alternative) method.

Determination of limit of detection

The limit of detection (LOD) was determined in two ways: (i) by determining the lowest detectable amount of DNA (copy number): decimal dilution series was prepared from the purified template DNA and the lowest DNA concentration that gave a positive result in the LAMP assay was determined. Considering the genome size of the L. monocytogenes CCM 4699 strain, the copy number was calculated as described above, and (ii) determining the lowest detectable viable cell number: cell suspensions were prepared from 24-hour cultures of L. monocytogenes grown in TSB or Fraser enrichment broth (30 °C, 190 rpm), which were treated with TZ buffer for 15 min at 65 and 100 °C both before and after decimal dilution. The lowest cell number that gave a positive result in the LAMP assay was determined. Experiments were performed in triplicate and in two independent replications.

Influence of E. coli on the LOD of InlA LAMP

E. coli NCAIM B01909 was cultivated in TSB at 30 °C for 24 h with shaking (190 rpm), and a suspension of 108 cell/mL was prepared, which was added at a 1:10 ratio to the TSB and Fraser broth cultures of L. monocytogenes CCM 4699 (108 cell/mL). Decimal dilution series were prepared, lysed by TZ buffer at 65 and 100 °C, respectively, and the LOD was determined.

RESULTS AND DISCUSSION

Development of a single-tube system for cell lysis, DNA extraction and end-point detection in L. monocytogenes

The effect of the alkaline lysis buffer HotSHOT+Tween and the Triton X-100 and sodium azide-based TZ buffer on the LAMP reaction were determined at their original concentrations (35, 37) as well as at 3× and 10× dilutions. A volume of 1 µL (50 ng) of purified template DNA, extracted from L. monocytogenes CCM 4699, was added to 10 µL of lysis buffers (Table 1) and used as a template in the LAMP mixtures targeting the hlyA gene (44). Separation of the reaction products by gel electrophoresis is shown in Fig. 1, which indicates that the HotSHOT 5×+Tween lysis buffer inhibited the LAMP reaction at the original concentration, but not at the diluted concentrations. In contrast, the HotSHOT 2×+Tween and TZ buffers had no inhibitory effect at all. The same results were obtained using turbidity for endpoint detection. We can conclude that using up to 10 µL of the template in HotSHOT 2×+Tween and TZ lysis buffers per LAMP reaction does not inhibit the amplification.

Effect of lysis buffers on the HlyA-old LAMP (loop-mediated isothermal amplification) reaction in original (1×) and diluted (1/10, 1/30) concentrations as detected by gel electrophoresis. Target gene: hlyA of L. monocytogenes CCM 4699. Template DNA was isolated with the use of MasterPure Complete DNA and RNA Purification Kit. Lanes 1–3=HotSHOT 5×+Tween (1×), (1/10), (1/30); lanes 4–6=HotSHOT 2×+Tween (1×), (1/10), (1/30); lanes 7–9=TZ (1×), (1/10), (1/30). +=positive control (template DNA in TE (Tris-EDTA) buffer), L=100 bp dsDNA ladder. Composition of HotSHOT and TZ buffers is shown in Table 1.


Next, we investigated whether lysing L. monocytogenes CCM 4699 cells with HotSHOT+Tween and TZ lysis buffers provides amplifiable DNA templates for the LAMP reaction. For the amplificability test, 1 µL of DNA solution (50 ng) extracted from the cell lysates or 1 µL of cell lysates was used as templates for the LAMP reaction. As shown in Table 3, positive results were obtained for every cell lysate and DNA extract using turbidity or gel electrophoresis for endpoint detection. Treating the cells with lysozyme prior to buffer administration did not significantly affect the results. We investigated whether reducing the temperature of the cell lysis in TZ buffer from 100 to 65 °C would result in adequate cell disintegration and DNA extraction. The results in Table 3 show that heat treatment at 65 °C for 15 min is sufficient to yield amplifiable template DNA, which is advantageous for microfluidic application.

Amplificability of DNA extracted from cell lysates and that of the cell lysates of L. monocytogenes CCM 4699 obtained with HotSHOT+Tween and TZ lysis buffers

Lysis buffer Treatment Template LAMP reaction
Turbidity Gel electrophoresis
     HotSHOT 2×+Tween - DNA + ++
     HotSHOT 5×+Tween - DNA + ++
     TZ (100 °C, 15 min) - DNA + ++
     TZ (65 °C, 15 min) - DNA + ++
     HotSHOT 2×+Tween L DNA + +
     HotSHOT 5×+Tween L DNA + +
     TZ (100 °C, 15 min) L DNA + ++
     TZ (65 °C, 15 min) L DNA + ++
     HotSHOT 2×+Tween - Cell lysate + ++
     HotSHOT 5×+Tween - Cell lysate + ++
     TZ (100 °C, 15 min) - Cell lysate + +++
     TZ (65 °C, 15 min) - Cell lysate + ++
     HotSHOT 2×+Tween L Cell lysate + +++
     HotSHOT 5×+Tween L Cell lysate + ++
     TZ (100 °C, 15 min) L Cell lysate + +++
     TZ (65 °C, 15 min) L Cell lysate + ++
     Positive control - Purified DNA + ++

Target gene: hlyA of L. monocytogenes. L=lysozyme treatment (6 mg/mL, 37 °C, 30 min) before adding the buffers; +=weak turbidity/amplicon patterns, ++=turbidity/amplicon patterns with medium intensity, +++=strong turbidity/amplicon patterns. Composition of HotSHOT and TZ buffers is shown in Table 1

The efficiency of DNA extraction using the HotSHOT+Tween and TZ lysis buffers was determined by measuring the amount of DNA extracted from the cell lysates. The genome copy number in the extracted DNA was calculated based on the known genome size of L. monocytogenes CCM 4699. The ratio of the genome copy number per mL of the extracted DNA to the cell number per mL of the initial cell suspension indicated the efficiency of the DNA extraction. The best result was obtained with the TZ lysis buffer, extracting up to 15 % of the genomic DNA. Much smaller amounts of DNA were extracted from the cells using the HotSHOT+Tween buffer, with only around 5 % of the genomic DNA present in the cell lysates. It should be mentioned that the efficiency of DNA extraction in the cell lysates exceeds the calculated values, as significant losses occur during DNA purification and concentration, particularly in small volumes (V≤100 µL).

The main conclusion is that all three lysis buffers result in amplifiable DNA template, with TZ lysis buffer being the most efficient in terms of the amount of extracted DNA. The amplification and sensing reactions of the LAMP assay can be performed in the same tube as the cell lysis when using HotSHOT 2×+Tween and TZ lysis buffers.

Designing LAMP primer sets for the detection of L. monocytogenes virulence genes

For the detection of L. monocytogenes in food, environmental and human samples, conventional and multiplex PCR are the most frequently used molecular techniques, typically targeting virulence genes (3). Most LAMP assays are also based on the detection of L. monocytogenes virulence genes. However, LAMP requires a much more extensive primer design than PCR, as it uses four or six different primers for amplification, which target six different regions of the gene.

In our previous work, we used a LAMP assay for the detection of L. monocytogenes strains based on the amplification of hlyA gene (44). However, in some cases we obtained false positive or negative results, even when the respective negative or positive controls worked properly. Consequently, in the development of a novel LAMP assay, we targeted different regions of the hlyA gene using LAMP primers and also included the inlA virulence gene. To detect these genes, we designed LAMP primer sets and determined the sensitivity and specificity of the LAMP inner primers, FIP and BIP, with an optimised PCR reaction. For this reaction, we designed inner PCR primer pairs F2-B2, based on the nucleotide sequences of the inner LAMP primers. Sensitivity and specificity of the PCR primers were tested against 12 L. monocytogenes and 15 other Listeria strains, respectively, which were reliably identified by phenotypic and molecular methods (Table 2). Results summarised in Table 4 indicate that the HlyA-new and InlA PCR primer pairs generated specific PCR products (in the range of 100–200 bp) for all L. monocytogenes strains, while the PCR reaction was negative for one strain with the HlyA-old primer pair. The HlyA-new and InlA PCR reactions did not yield amplicons of the expected size for any of the 15 non-monocytogenes Listeria strains; however, non-specific PCR products could be visualised by gel electrophoresis in all three PCR reactions in rare cases. PCR products of various sizes and low intensity appeared primarily in L. innocua and L. ivanovii strains, although their visibility was different in the three replicates in several cases. Based on the results, the calculated sensitivity and specificity of both the HlyA-new and InlA PCR reactions were 100 %, while these were only 92 and 87 % for the HlyA-old, respectively. Considering that the InlA PCR reaction generated the fewest non-specific products, we selected the InlA LAMP assay for further experiments.

Results of PCR using F2-B2 internal PCR primers targeting the hlyA and inlA genes of L. monocytogenes strains

PCR
No. Strain HlyA-old HlyA-new InlA
L. monocytogenes strains
1 L. monocytogenes CCM 4699 + + +
2 L. monocytogenes NCAIM B01966 + + +
3 L. monocytogenes NCTC 5105 + + +
4 L. monocytogenes DMB E ST/10.12. 2 + + +
5 L. monocytogenes DMB E 12/10.12. 3 + + +
6 L. monocytogenes DMB H1 + + +
7 L. monocytogenes DMB H2 + + +
8 L. monocytogenes DMB 80 + + +
9 L. monocytogenes DMB H6 + + +
10 L. monocytogenes DMB 43 + + +
11 L. monocytogenes DMB 46 + + +
12 L. monocytogenes DMB 8 + +
Non-monocytogenes Listeria strains
1 L. innocua NCAIM B01830
2 L. innocua DMB 1969 (+)
3 L. innocua CCM 4030T (+)
4 L. innocua DMB 4191
5 L. innocua DMB 291
6 L. innocua DMB 217
7 L. grayi DMB 1161
8 L. grayi DMB 1161
9 L. ivanovii ssp. ivanovii CCM 5884T +
10 L. ivanovii DMB 1150 +
11 L. ivanovii DMB T7 (+) (+) (+)
12 L. ivanovii DMB 1149 (+) (+) (+)
13 L. seeligeri DMB 1153
14 L. welshimeri CCM 3971T
15 L. welshimeri DMB 1157
NC Negative control (without template DNA)

Template DNA was isolated with the use of MasterPure Complete DNA and RNA Purification Kit. +=positive PCR reaction, −=negative PCR reaction, (+)=non-specific PCR reaction

It is worth noting that the higher primer annealing temperature in the LAMP than in the PCR reaction (65 vs 52 °C) can significantly reduce non-specific primer binding and the generation of false positive LAMP products.

Application of the eriochrome black T for endpoint detection of LAMP assay

Biosensors for LAMP with turbidity-based real-time monitoring and endpoint detection are very simple and widespread. The drawback of applying these systems in microfluidic devices is that visual assessment is subjective and uncertain, and nephelometric microsensors are not yet commercially available. Colorimetric endpoint detection seems more convenient and cheaper in LAMP, especially in microfluidic sensors.

We tested the robustness of the hydroxynaphthol blue (HNB) colorimetric detection method (22) and found that although the colour change was easily detected, the reaction needed to be optimised and standardised for the conditions of each LAMP reaction. The HNB concentration and LAMP reaction time were particularly important factors (data not shown). We also investigated the applicability of another metal indicator, eriochrome black T (EBT), for colorimetric endpoint detection (23) and compared it with the turbidity visualisation, using the InlA LAMP assay, and including L. monocytogenes and non-monocytogenes Listeria strains in the tests. Results in Fig. 2 show that L. monocytogenes strains were positive with both the EBT (Fig. 2a) and turbidity (Fig. 2b) reactions. For non-monocytogenes Listeria strains, the EBT reaction was clearly negative, while turbidity was only rarely weakly positive in one of the three parallel samples (2/3 and 3/1). Therefore, we applied EBT endpoint detection in the subsequent LAMP experiments.

Detection of L. monocytogenes (1) and non-monocytogenes Listeria (4, 2/1, 2/2, 2/3, 3/1, 3/2, 3/3) strains by InlA LAMP (loop-mediated isothermal amplification) assay using: a) EBT (eriochrome black T) endpoint reaction (blue=positive, purple=negative) and b) turbidity endpoint reaction (turbid=positive, clear=negative). Strains: 1=L. monocytogenes NCAIM B01966; 2/1, 2/2, 2/3=L. innocua CCM 4030T; 3/1, 3/2, 3/3=Listeria welshimeri CCM 3971T; 4=L. ivanovii ssp. ivanovii CCM 5884T; NC=negative control (LAMP reaction mixture without template DNA). Template DNA was isolated with the use of MasterPure Complete DNA and RNA Purification Kit


Evaluation of the InlA LAMP assay developed for the detection of Listeria monocytogenes

Performance characteristics of the InlA LAMP assay were evaluated using ten strains of each of L. monocytogenes, non-monocytogenes Listeria and non-Listeria (Table 2). Sensitivity, specificity, and LOD were calculated as the most critical performance characteristics.

Fig. 3 shows the results obtained with L. monocytogenes (Fig. 3a), non-monocytogenes Listeria (Fig. 3b), and non-Listeria bacterial strains (Fig. 3c), presenting typical series of EBT reactions.

Positive and negative InlA LAMP (loop-mediated isothermal amplification) results testing of: a) ten L. monocytogenes, b) ten non-monocytogenes Listeria and c) ten non-Listeria bacterial strains by EBT (eriochrome black T) endpoint reaction. Template DNA was isolated with the use of MasterPure Complete DNA and RNA Purification Kit. Numbers indicate the strains listed in Table 2. NC=negative control (LAMP reaction mixture without template DNA); PC=positive control (LAMP reaction with L. monocytogenes CCM 4699 template DNA)


For sensitivity (SE), the ratio of the number of L. monocytogenes strains resulting positive in the LAMP test to the number of true positives was determined, while in the case of specificity (SP), the ratio of the number of non-monocytogenes Listeria and non-Listeria bacterial strains that gave negative LAMP results to the true negatives was calculated.

The sensitivity of the InlA LAMP assay was 100 %, as all 10 L. monocytogenes strains gave positive LAMP results in repeated experiments. This finding is consistent with the results obtained in the InlA PCR reaction. The specificity was 92 % for the non-monocytogenes Listeria strains, as 8 % of the LAMP tests were false positives; it was 100 % for the non-Listeria bacteria, and 96 % when all non-L. monocytogenes strains were considered collectively. In some cases, one of the three parallel reactions was positive, likely due to a slight decrease in Mg2+ concentration in the reaction mixture. This is because non-specific amplification can occur in the presence of a substantial amount of DNA released from the background microbiota (47, 48). As shown by Francois et al. (19), weak amplification of template DNA can also occur in the absence of the target gene. Furthermore, the negative control sample can be significantly amplified if sample preparation conditions (temperature and time) and the amplification period are not optimal. Notably, the false positive results did not originate from the same Listeria species that produced weak, non-specific PCR products in the InlA PCR reaction.

LOD refers to the smallest amount of template DNA and the corresponding calculated genome copy number, as well as the smallest amount of living cell count that can be detected by the applied LAMP assay (19). The lowest detectable amount of DNA by LAMP (LOD) was determined using decimal dilutions of DNA extracted from L. monocytogenes CCM 4699, with the last positive result at the 10-5 dilution. Based on this result, the calculated amount of genomic DNA that can be reproducibly detected in the LAMP reaction (V=25 µL) is 500 fg, which corresponds to 157 genome copy numbers. The calculated LOD per unit reaction volume is 20 fg/µL, or 6.3 copy/µL. This is close to the LOD value of LAMP obtained by Nathaniel et al. (29) for the lmo0753 gene of L. monocytogenes and by Francois et al. (19) for Salmonella; however, it is ten times lower than that obtained by Busch et al. (28) for LAMP developed for the mpl gene of L. monocytogenes. Oh et al. (23) reported a similar LOD using LAMP with EBT sensing for the detection of E. coli O157:H7 in a centrifugal microfluidic device.

Detection of L. monocytogenes with InlA LAMP by direct amplification from cell lysate

Traditional detection of L. monocytogenes in food, environmental and human samples by LAMP includes culturing the samples in a selective medium, followed by DNA isolation from the typical colonies for detection. When the number of L. monocytogenes cells is low, a one- or two-step enrichment process is initiated using appropriate culture media, applying a quantity of food samples corresponding to the limit value. These samples are then cultured to assess the presence or absence of L. monocytogenes. This can be achieved by further cultivation in a selective culture medium and confirmation of the typical colonies or identification by culture-based or culture-independent (e.g. genomic) techniques (11, 12, 15).

It is necessary to check whether enrichment media inhibit the reaction at the applied concentrations. Since Fraser selective broth is one of the most frequently used and well-established media for selective enrichment of L. monocytogenes in food (13), its inhibitory effect on LAMP was investigated. According to the results, adding the maximum template volume (V=4 µL) to the reaction mixture did not inhibit the LAMP reaction. This indicates that the enriched culture can be used directly for cell lysis, and then as a template for the LAMP reaction. Since enrichment occurs in two consecutive steps, the inhibitory effect of the food matrix on the LAMP reaction should not be expected, as the first broth (half-Fraser or other) containing the food sample is diluted 100-fold in the second (Fraser) broth.

Since the TZ buffer proved to be the most efficient of the tested lysis buffers, it was selected for the disintegration of L. monocytogenes cells. The applicability of the resulting cell lysates for direct detection of L. monocytogenes using the InlA LAMP assay was then tested. Cultures of L. monocytogenes CCM 4699 grown in either TSB or Fraser enrichment medium were lysed in TZ buffer. The efficiency of cell lysis at 100 and 65 °C for 15 min was compared by the determination of LOD values. Results are summarised in Table 5.

Limit of detection (LOD) values of the InlA LAMP (loop-mediated isothermal amplification) assay determined by L. monocytogenes CCM 4699 single cultures or co-cultures with E. coli ATCC 8739, prepared in tryptic soy broth (TSB) and Fraser enrichment broth

Temperature/°C Culture medium Species Lysis with buffer N/(cell/mL) N/(cell/reaction) V=25 µL N/(cell/µL)
TSB L. monocytogenes Before dilution 104 100 4
TSB L. monocytogenes After dilution 103 10 0.4
100 TSB L. monocytogenes+E. coli After dilution 104 100 4
Fraser L. monocytogenes Before dilution 105 1000 40
Fraser L. monocytogenes After dilution 104 100 4
Fraser L. monocytogenes+E. coli After dilution 104 100 4
TSB L. monocytogenes Before dilution 105 1000 40
TSB L. monocytogenes After dilution 104 100 4
65 TSB L. monocytogenes+E. coli After dilution 105 1000 40
Fraser L. monocytogenes Before dilution 106 10000 400
Fraser L. monocytogenes After dilution 104 100 4
Fraser L. monocytogenes+E. coli After dilution 104 100 4

The cultures were lysed in TZ buffer (composition is in Table 1) at 100 °C and 65 °C for 15 min

Adding diluted suspensions of TSB cultures lysed by TZ buffer at 100 °C as templates in the InlA LAMP reaction resulted in an LOD similar to that obtained with purified DNA. The LOD was in the range of 100 cells per reaction, indicating that L. monocytogenes could be reliably detected in suspensions of ≥104 cell/mL. Cell lysis with TZ buffer at 65 °C increased the LOD by one order of magnitude. In Fraser cultures, the LOD was one order of magnitude higher than in TSB at both lysis temperatures, which could be attributed to the presence of several inhibitory compounds in the Fraser broth that make the cells tolerant to the lysing effect of the TZ buffer.

The number of L. monocytogenes cells at the end of the enrichment period depends on the initial number of cells in the sample and their ability to grow in the pre-enrichment (half-Fraser) and enrichment (Fraser) broths (49). Therefore, it is expected that L. monocytogenes will need to be detected in positive samples with different cell numbers. To test the effect of cell numbers on the LOD, decimal dilution series of TSB and Fraser cultures (108 cell/mL) were prepared in the corresponding culture medium. The dilution series members were then lysed individually with TZ buffer at 65 and 100 °C, and the lysed samples were used as templates for the InlA LAMP assay. Lysing the dilution series members individually resulted in a one-order-of-magnitude decrease in the LOD most of the time for both the TSB and Fraser enrichment media at 65 and 100 °C (Table 5). It can be concluded that the efficiency with which TZ buffer lyses cells increases at concentrations below 108 cell/mL at both 100 and 65 °C, and that L. monocytogenes can be reliably detected in samples even at low cell number (≤104 cell/mL) after enrichment.

During the selective enrichment of L. monocytogenes, non-Listeria cells present in the food sample may also grow at a low rate. Therefore, we tested whether adding E. coli cells at a ratio of 1:10 to L. monocytogenes TSB and Fraser broth cultures affects the LOD values. Results in Table 5 show that the presence of E. coli cells during cell lysis has practically no influence on the LOD values, confirming high specificity and robustness of the developed InlA LAMP assay.

As the continuation of the present work, validation of the developed InlA LAMP assay according to the ISO 16140-2:2016 (50) is the next step using different food categories artificially inoculated and naturally contaminated with L. monocytogenes.

CONCLUSIONS

The selection and improvement of inhibitor-free cell lysing processes for DNA extraction and amplification offer a new approach for the development of a single-tube loop-mediated isothermal amplification (LAMP) assay that can be directly applied to detect the most important foodborne pathogen, Listeria monocytogenes, in food after enrichment. It has been demonstrated that the selected TZ lysis buffer, when added at a volume equivalent to one-sixth of the LAMP reaction volume, does not inhibit the amplification process and does not affect the eriochrome black T (EBT) sensing reaction.

The use of genome sequencing data analysis and testing the LAMP primer specificity and sensitivity by PCR reaction enabled the selection of InlA as the target gene for detection. It was shown that the sensitivity of the hlyA LAMP assay could be improved and that the highest specificity was achieved using the InlA target gene. To the best of our knowledge, this gene has not been used previously in a LAMP assay.

The developed single-tube InlA LAMP assay has been shown to be suitable for the detection of enriched L. monocytogenes cultures under laboratory conditions. Furthermore, it has the potential to be further developed for on-site detection with microfluidic devices.

ACKNOWLEDGEMENTS

ACKNOWLEDGEMENT

This paper is dedicated to the memory of Professor Vladimir Mrša, who was the editor-in-chief of Food Technology and Biotechnology and our close collaborative partner in science and education until his sad death in 2024.

FUNDING

This work was supported by the National Research, Development, and Innovation Fund of Hungary; project numbers ED_14-1-2014-0002 (Establishment of the Bionic Innovation Centre) and ED_17-1-2017-0009 (National Bionics Program).

AUTHORS' CONTRIBUTION

AM, AB and KI contributed by conception and design of the work. AM, AB and MP performed the data collection, analysis and interpretation. AM drafted the article, AB performed critical revision, and AM and AB prepared the final version to be published. All authors were involved in the final approval of the version to be published.

REFERENCES
  1. Bintsis T. Foodborne pathogens. AIMS Microbiol. 2017;3(3):529-63, https://doi.org/10.3934/microbiol.2017.3.529, PubMed: https://www.ncbi.nlm.nih.gov/pubmed/24377856/31294175
  2. Scallan Walter E, Cui Z, Tierney R, Griffin P, Hoekstra R, Payne D. Foodborne illness acquired in the United States — Major pathogens, 2019. Emerg Infect Dis. 2025;31(4):669-77, https://doi.org/10.3201/eid3104.240913, PubMed: https://www.ncbi.nlm.nih.gov/pubmed/24377856/40133035
  3. Ravindhiran R, Sivarajan K, Sekar J, Murugesan R, Dhandapani K. Listeria monocytogenes an emerging pathogen: A comprehensive overview on listeriosis, virulence determinants, detection, and anti-listerial interventions. Microb Ecol. 2023;86:2231-51, https://doi.org/10.1007/s00248-023-02269-9, PubMed: https://www.ncbi.nlm.nih.gov/pubmed/24377856/37479828
  4. de Noordhout C, Devleesschauwer B, Angulo F, Verbeke G, Haagsma J, Kirk M. The global burden of listeriosis: A systematic review and meta-analysis. Lancet Infect Dis. 2014;14(11):1073-82, https://doi.org/10.1016/S1473-3099(14)70870-9, PubMed: https://www.ncbi.nlm.nih.gov/pubmed/24377856/25241232
  5. Orsi R, den Bakker H, Wiedmann M. Listeria monocytogenes lineages: Genomics, evolution, ecology, and phenotypic characteristics. Int J Med Microbiol. 2011;301(2):79-96, https://doi.org/10.1016/j.ijmm.2010.05.002, PubMed: https://www.ncbi.nlm.nih.gov/pubmed/24377856/20708964
  6. Thakur M, Asrani RK, Patial V. Listeria monocytogenes: A food-borne pathogen. In: Holban AM, Grumezescu AM, editors. Foodborne diseases. Handbook of food bioengineering. Cambridge, MA, USA: Academic Press; 2018. pp. 157-92. 10.1016/B978-0-12-811444-5.00006-3, https://doi.org/10.1016/B978-0-12-811444-5.00006-3
  7. Zeng D, Chen Z, Jiang Y, Xue F, Li B. Advances and challenges in viability detection of foodborne pathogens. Front Microbiol. 2016;7:1833, https://doi.org/10.3389/fmicb.2016.01833, PubMed: https://www.ncbi.nlm.nih.gov/pubmed/24377856/27920757
  8. Gurtler J, Keller S, Kornacki J, Annous B, Jin T, Fan X. Challenges in recovering foodborne pathogens from low-water-activity foods. J Food Prot. 2019;82(6):988-96, https://doi.org/10.4315/0362-028X.JFP-18-204, PubMed: https://www.ncbi.nlm.nih.gov/pubmed/24377856/31121101
  9. Orsi R, Liao J, Carlin C, Wiedmann M. Taxonomy, ecology, and relevance to food safety of the genus Listeria with a particular consideration of new Listeria species described between 2010 and 2022. MBio. 2024;15(2), https://doi.org/10.1128/mbio.00938-23, PubMed: https://www.ncbi.nlm.nih.gov/pubmed/24377856/38126771
  10. Zhao T, Doyle M. Evaluation of universal preenrichment broth for growth of heat-injured pathogens. J Food Prot. 2001;64(11):1751-5, https://doi.org/10.4315/0362-028X-64.11.1751, PubMed: https://www.ncbi.nlm.nih.gov/pubmed/24377856/11726154
  11. Baraketi A, Salmieri S, Lacroix M. Foodborne pathogens detection: Persevering worldwide challenge. In: Rinken T, Kivirand K, editors. Biosensing technologies for the detection of pathogens - A prospective way for rapid analysis. London, UK: IntechOpen; 2018. pp. 53-72. 10.5772/intechopen.74421, https://doi.org/10.5772/intechopen.74421
  12. Hahm B, Kim H, Singh A, Bhunia A. Pathogen enrichment device (PED) enables one-step growth, enrichment and separation of pathogen from food matrices for detection using bioanalytical platforms. J Microbiol Methods. 2015;117:64-73, https://doi.org/10.1016/j.mimet.2015.07.016, PubMed: https://www.ncbi.nlm.nih.gov/pubmed/24377856/26211638
  13. ISO 11290-1:2017. Microbiology of the food chain — Horizontal method for the detection and enumeration of Listeria monocytogenes and of Listeria spp. Part 1: Detection method. Geneva, Switzerland: International Organization for Standardization (ISO); 2017.
  14. Holbrook R. Detection of microorganisms in foods – Principles of culture methods. In: Lund B, Baird-Parker TC, Gould GW, editors. The microbiological safety and quality of food. Gaithersburg, MD, USA: An Aspen Publication; 2000. pp. 1761-90.
  15. Maráz A, Marin F, Cava R, Rajkovic A. Microbial analysis of food. In: Luning P, Devlieghere R, Verhe R, editors. Safety in the agri-food chain. Wageningen, The Netherlands: Wageningen Academic Publishers; 2006. pp. 471-522.
  16. Notomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe K, Amino N. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 2000;28(12): e63, https://doi.org/10.1093/nar/28.12.e63, PubMed: https://www.ncbi.nlm.nih.gov/pubmed/24377856/10871386
  17. Wong Y, Othman S, Lau Y, Radu S, Chee H. Loop-mediated isothermal amplification (LAMP): A versatile technique for detection of micro-organisms. J Appl Microbiol. 2018;124(3):626-43, https://doi.org/10.1111/jam.13647, PubMed: https://www.ncbi.nlm.nih.gov/pubmed/24377856/29165905
  18. Tomita N, Mori Y, Kanda H, Notomi T. Loop-mediated isothermal amplification (LAMP) of gene sequences and simple visual detection of products. Nat Protoc. 2008;3:877-82, https://doi.org/10.1038/nprot.2008.57, PubMed: https://www.ncbi.nlm.nih.gov/pubmed/24377856/18451795
  19. Francois P, Tangomo M, Hibbs J, Bonetti E, Boehme C, Notomi T. Robustness of a loop-mediated isothermal amplification reaction for diagnostic applications. FEMS Immunol Med Microbiol. 2011;62(1):41-8, https://doi.org/10.1111/j.1574-695X.2011.00785.x, PubMed: https://www.ncbi.nlm.nih.gov/pubmed/24377856/21276085
  20. Mori Y, Nagamine K, Tomita N, Notomi T. Detection of loop-mediated isothermal amplification reaction by turbidity derived from magnesium pyrophosphate formation. Biochem Biophys Res Commun. 2001;289(1):150-4, https://doi.org/10.1006/bbrc.2001.5921, PubMed: https://www.ncbi.nlm.nih.gov/pubmed/24377856/11708792
  21. Novi V, Meher A, Abbas A. Visualization methods for loop mediated isothermal amplification (LAMP) assays. Analyst. 2025;150(4):588-99, https://doi.org/10.1039/D4AN01287A, PubMed: https://www.ncbi.nlm.nih.gov/pubmed/24377856/39895350
  22. Goto M, Honda E, Ogura A, Nomoto A, Hanaki K. Colorimetric detection of loop-mediated isothermal amplification reaction by using hydroxy naphthol blue. Biotechniques. 2009;46(3):167-72, https://doi.org/10.2144/000113072, PubMed: https://www.ncbi.nlm.nih.gov/pubmed/24377856/19317660
  23. Oh S, Park B, Jung J, Choi G, Lee D, Kim D. Centrifugal loop-mediated isothermal amplification microdevice for rapid, multiplex and colorimetric foodborne pathogen detection. Biosens Bioelectron. 2016;75:293-300, https://doi.org/10.1016/j.bios.2015.08.052, PubMed: https://www.ncbi.nlm.nih.gov/pubmed/24377856/26322592
  24. Milillo S, Badamo J, Wiedmann M. Contributions to selected phenotypic characteristics of large species- and lineage-specific genomic regions in Listeria monocytogenes. Food Microbiol. 2009;26(2):212-23, https://doi.org/10.1016/j.fm.2008.08.010, PubMed: https://www.ncbi.nlm.nih.gov/pubmed/24377856/19171265
  25. Phelps C, Vadia S, Arnett E, Tan Y, Zhang X, Pathak-Sharma S. Relative roles of Listeriolysin O, InlA, and InlB in Listeria monocytogenes uptake by host cells. Infect Immun. 2018;86(10):e00555-18, https://doi.org/10.1128/IAI.00555-18, PubMed: https://www.ncbi.nlm.nih.gov/pubmed/24377856/30061379
  26. Raybourne R. Virulence testing of Listeria monocytogenes. J AOAC Int. 2002;85(2):516-23, https://doi.org/10.1093/jaoac/85.2.516, PubMed: https://www.ncbi.nlm.nih.gov/pubmed/24377856/11990040
  27. Bubert A, Kestler H, Götz M, Böckmann R, Goebel W. The Listeria monocytogenes iap gene as an indicator gene for the study of PrfA-dependent regulation. Mol Gen Genet. 1997;256:54-62, https://doi.org/10.1007/s004380050545, PubMed: https://www.ncbi.nlm.nih.gov/pubmed/24377856/9341679
  28. Busch A, Becker A, Schotte U, Plötz M, Abdulmawjood A. Mpl-gene-based loop-mediated isothermal amplification assay for specific and rapid detection of Listeria monocytogenes in various food samples. Foodborne Pathog Dis. 2022;19(7):463-72, https://doi.org/10.1089/fpd.2021.0080, PubMed: https://www.ncbi.nlm.nih.gov/pubmed/24377856/35099299
  29. Nathaniel B, Ghai M, Druce M, Maharaj I, Olaniran A. Development of a loop-mediated isothermal amplification assay targeting lmo0753 gene for detection of Listeria monocytogenes in wastewater. Lett Appl Microbiol. 2019;69(4):264-70, https://doi.org/10.1111/lam.13200, PubMed: https://www.ncbi.nlm.nih.gov/pubmed/24377856/31323126
  30. Srisawat W, Saengthongpinit C, Nuchchanart W. Development of loop-mediated isothermal amplification-lateral flow dipstick as a rapid screening test for detecting Listeria monocytogenes in frozen food products using a specific region on the ferrous iron transport protein B gene. Vet World. 2022;15(3):590-601, https://doi.org/10.14202/vetworld.2022.590-601, PubMed: https://www.ncbi.nlm.nih.gov/pubmed/24377856/35497940
  31. Elizaquível P, Aznar R. Comparison of four commercial DNA extraction kits for PCR detection of Listeria monocytogenes, Salmonella, Escherichia coli O157:H7, and Staphylococcus aureus in fresh, minimally processed vegetables. J Food Prot. 2008;71(10):2110-4, https://doi.org/10.4315/0362-028X-71.10.2110, PubMed: https://www.ncbi.nlm.nih.gov/pubmed/24377856/18939762
  32. Claassen S, du Toit E. kaba M, Moodley C, Zar HJ, Nicol MP. A comparison of the efficiency of five different commercial DNA extraction kits for extraction of DNA from faecal samples. J Microbiol Methods. 2013;94(2):103-10, https://doi.org/10.1016/j.mimet.2013.05.008, PubMed: https://www.ncbi.nlm.nih.gov/pubmed/24377856/23684993
  33. Quigley L, O’Sullivan O, Beresford T, Ross R, Fitzgerald G, Cotter P. A comparison of methods used to extract bacterial DNA from raw milk and raw milk cheese. J Appl Microbiol. 2012;113(1):96-105, https://doi.org/10.1111/j.1365-2672.2012.05294.x, PubMed: https://www.ncbi.nlm.nih.gov/pubmed/24377856/22452460
  34. Truett G, Heeger P, Mynatt R, Truett A, Walker J, Warman M. Preparation of PCR-quality mouse genomic DNA with hot sodium hydroxide and tris (HotSHOT). Biotechniques. 2000;29(1):52-4, https://doi.org/10.2144/00291bm09, PubMed: https://www.ncbi.nlm.nih.gov/pubmed/24377856/10907076
  35. Brewster J, Paoli G. DNA extraction protocol for rapid PCR detection of pathogenic bacteria. Anal Biochem. 2013;442(1):107-9, https://doi.org/10.1016/j.ab.2013.07.013, PubMed: https://www.ncbi.nlm.nih.gov/pubmed/24377856/23872000
  36. Agersborg A, Dahl R, Martinez I. Sample preparation and DNA extraction procedures for polymerase chain reaction identification of Listeria monocytogenes in seafoods. Int J Food Microbiol. 1997;35(3):275-80, https://doi.org/10.1016/S0168-1605(97)01245-2, PubMed: https://www.ncbi.nlm.nih.gov/pubmed/24377856/9105938
  37. Abolmaaty A, Vu C, Oliver J, Levin R. Development of a new lysis solution for releasing genomic DNA from bacterial cells for DNA amplification by polymerase chain reaction. Microbios. 2000;101(400):181-9, PubMed: https://www.ncbi.nlm.nih.gov/pubmed/24377856/10756522
  38. Lonchamps P, He Y, Wang K, Lu X. Detection of pathogens in foods using microfluidic “lab-on-chip”: A mini review. J Agric Food Res. 2022;10, https://doi.org/10.1016/j.jafr.2022.100430
  39. Nnachi R, Sui N, Ke B, Luo Z, Bhalla N, He D. Biosensors for rapid detection of bacterial pathogens in water, food and environment. Environ Int. 2022;166, https://doi.org/10.1016/j.envint.2022.107357, PubMed: https://www.ncbi.nlm.nih.gov/pubmed/24377856/35777116
  40. Puiu M, Bala C. Microfluidics-integrated biosensing platforms as emergency tools for on-site field detection of foodborne pathogens. Trends Analyt Chem. 2020;125, https://doi.org/10.1016/j.trac.2020.115831
  41. Sowmya N, Thakur M, Manonmani H. Rapid and simple DNA extraction method for the detection of enterotoxigenic Staphylococcus aureus directly from food samples: Comparison of PCR and LAMP methods. J Appl Microbiol. 2012;113(1):106-13, https://doi.org/10.1111/j.1365-2672.2012.05315.x, PubMed: https://www.ncbi.nlm.nih.gov/pubmed/24377856/22519925
  42. Staroscik A. Copy number calculator. Technology Networks Ltd, Sudbury, UK; 2004. Available from: https://www.technologynetworks.com/tn/tools/copynumbercalculator
  43. O’Leary N, Cox E, Holmes J, Anderson W, Falk R, Hem V. Exploring and retrieving sequence and metadata for species across the tree of life with NCBI Datasets. Sci Data. 2024;11(1):732, https://doi.org/10.1038/s41597-024-03571-y, PubMed: https://www.ncbi.nlm.nih.gov/pubmed/24377856/38969627
  44. Tang M, Zhou S, Zhang X, Pu J, Ge Q, Tang X. Rapid and sensitive detection of Listeria monocytogenes by loop-mediated isothermal amplification. Curr Microbiol. 2011;63:511, https://doi.org/10.1007/s00284-011-0013-3, PubMed: https://www.ncbi.nlm.nih.gov/pubmed/24377856/21935669
  45. PrimerExplorer V5, Eiken Chemical Co, Tokyo, Japan; 2017. Available from: https://primerexplorer.jp/e/
  46. Wang Y, Wang Y, Ma A, Li D, Luo L, Liu D. The novel multiple inner primers-loop-mediated isothermal amplification (MIP-LAMP) for rapid detection and differentiation of Listeria monocytogenes. Molecules. 2015;20(12):21515-31, https://doi.org/10.3390/molecules201219787, PubMed: https://www.ncbi.nlm.nih.gov/pubmed/24377856/26633345
  47. Yamazaki W, Taguchi M, Kawai T, Kawatsu K, Sakata J, Inoue K. Comparison of loop-mediated isothermal amplification assay and conventional culture methods for detection of Campylobacter jejuni and Campylobacter coli in naturally contaminated chicken meat samples. Appl Environ Microbiol. 2009;75(6):1597-603, https://doi.org/10.1128/AEM.02004-08, PubMed: https://www.ncbi.nlm.nih.gov/pubmed/24377856/19139242
  48. Lee J, Kim S, Mun H, Kim S, Ha K, Shim W. A rapid and colorimetric loop-mediated isothermal amplification (LAMP) based on HRP-mimicking molecular beacon for the detection of major 6 Listeria species in enoki mushroom. Food Control. 2022;133(Part A), https://doi.org/10.1016/j.foodcont.2021.108569
  49. Bannenberg J, Abee T, Zwietering M, den Besten H. Variability in lag duration of Listeria monocytogenes strains in half Fraser enrichment broth after stress affects the detection efficacy using the ISO 11290-1 method. Int J Food Microbiol. 2021;337, https://doi.org/10.1016/j.ijfoodmicro.2020.108914, PubMed: https://www.ncbi.nlm.nih.gov/pubmed/24377856/33166913
  50. ISO 16140-2:2016. Microbiology of the food chain - Method validation. Part 2: Protocol for the validation of alternative (proprietary) methods against a reference method. Geneva, Switzerland: International Organization for Standardization (ISO); 2016.